Ferrienterochelin and colicins
WebOuter membrane receptor for ferrienterochelin and colicins; TonB-dependent siderophore receptor; Function unclear : 0.403: Your Current Organism: Alcanivorax borkumensis. NCBI taxonomy Id: 393595 Other names: A. borkumensis SK2, Alcanivorax borkumensis SK2, Alcanivorax borkumensis str. SK2, Alcanivorax borkumensis strain SK2 WebWe have determined the nucleotide sequence of the Escherichia coli fepA gene, which codes for the outer membrane receptor for ferrienterochelin and colicins B and D. The …
Ferrienterochelin and colicins
Did you know?
WebK12689 capA; campylobacter adhesion protein K19231 bmaC; fibronectin-binding autotransporter adhesin K16081 algE; alginate production protein K19611 fepA, pfeA, iroN, pirA; ferric enterobactin receptor K16090 fiu; catecholate siderophore receptor K16091 fecA; Fe(3+) dicitrate transport protein K16092 btuB; vitamin B12 transporter K21573 susC ... WebMar 1, 1991 · The determined nucleotide sequence of the Escherichia coli fepA gene, which codes for the outer membrane receptor for ferrienterochelin and colicins B and D, suggests that the amino-terminal end of these four polypeptides is involved in interaction with the TonB protein or another step of energy transduction. 46 PDF
WebOuter membrane receptor for ferrienterochelin and colicins [Inorganic ion transport and metabolism] Links? Taxonomy: Proteobacteria: Statistics? Accession: cl34814: PSSM Id: 361690: Name: FepA: Created: 19-Sep-2024: Updated: …
WebBXY_11110 Outer membrane receptor for ferrienterochelin and colicins [] Gene ID: 15191501, discontinued on 20-May-2015. Summary. Gene provides a unified query … Web(biochemistry) The iron complex of the siderophore enterochelin
A colicin is a type of bacteriocin produced by and toxic to some strains of Escherichia coli. Colicins are released into the environment to reduce competition from other bacterial strains. Colicins bind to outer membrane receptors, using them to translocate to the cytoplasm or cytoplasmic membrane, where … See more Channel-forming colicins (colicins A, B, E1, Ia, Ib, and N) are transmembrane proteins that depolarize the cytoplasmic membrane, leading to dissipation of cellular energy. These colicins contain at least three … See more Most colicins are able to translocate the outer membrane by a two-receptor system, where one receptor is used for the initial binding and the second for translocation. The … See more Virtually all colicins are carried on plasmids. The two general classes of colicinogenic plasmids are large, low-copy-number plasmids, and small, high-copy-number plasmids. The larger plasmids carry other genes, as well as the colicin operon. The colicin operons are … See more Because they target specific receptors and use specific translocation machinery, cells can make themselves resistant to the colicin by repressing or deleting the genes for these proteins. … See more • Molecular mechanisms of colicin evolution pdf • The newly characterized colicin Y provides evidence of positive selection in pore-former colicin diversification • Colicin OPM database See more
WebMap location of the cbr gene coding for production of the outer membrane receptor for ferrienterochelin and colicins B and D in Escherichia coli K-12 Anthony P. Pugsley Pages 275-277 lg phones troubleshootingWebA high intake of dietary saturated fatty acids (SFAs) is related to an increased risk of obesity, inflammation and cancer-related diseases, and this risk is attenuated only when SFAs are replaced by unsaturated fats and unrefined carbohydrates. The gut microbiota has recently emerged as a new environmental factor in the pathophysiology of these disorders, and is … lg phones terribleWebAug 15, 1986 · We have determined the nucleotide sequence of the Escherichia coli fepA gene, which codes for the outer membrane receptor for ferrienterochelin and colicins … mcdonald\u0027s oxford miWebSep 26, 2024 · Gene clusters similar to known bacteriocins have been described in other Aeromonas genomes , and the receptor for ferrienterochelin and colicins was identified in A. salmonicida subsp. pectinolytica 34melT genome . However, no correlation between the presence of these clusters and bacteriocin activity has been reported until now. lg phones timelineWebTonB-dependent receptor%3B Outer membrane receptor for ferrienterochelin and colicins;Note=TonB-dependent receptor%3B Outer membrane receptor for ferrienterochelin and colicinsAFTF01000225.1: 51 ... lg phones to maxWebLocus tag: blr4504 Name: fhuA1 Funciton: Outer membrane receptor for ferrienterochelin and colicins blr4504. fhuA1. Outer membrane receptor for ferrienterochelin and colicins. Position: -62 Score: 4.6 Sequence: AGCTTAGAACGCTTCTATGCC Locus tag: bll5796 Name: fumA Funciton: Fumarate hydratase class I, aerobic (EC 4.2.1.2) bll5796. fumA ... mcdonald\\u0027s oxford circusWebBXY_29250 Outer membrane receptor for ferrienterochelin and colicins [] Gene ID: 15193187, discontinued on 20-May-2015. Summary. Gene provides a unified query environment for genes defined by sequence and/or in NCBI's Map Viewer. BXY_29250 Outer membrane receptor for ferrienterochelin and colicins [] Gene ID: 15193187 ... mcdonald\\u0027s oxford street london